ID: 960465963

View in Genome Browser
Species Human (GRCh38)
Location 3:117997079-117997101
Sequence CTCCGGTTCTGGATGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465963_960465980 25 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465980 3:117997127-117997149 GGAGCCCGGCGGCAGGGAGGAGG No data
960465963_960465978 22 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465978 3:117997124-117997146 CCCGGAGCCCGGCGGCAGGGAGG No data
960465963_960465970 11 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465963_960465974 18 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465974 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG No data
960465963_960465975 19 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465963_960465968 4 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465963_960465982 27 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465963_960465981 26 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465963_960465972 14 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465972 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
960465963_960465983 28 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465983 3:117997130-117997152 GCCCGGCGGCAGGGAGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465963 Original CRISPR CTCCGGTTCTGGATGGAACA GGG (reversed) Intergenic