ID: 960465965

View in Genome Browser
Species Human (GRCh38)
Location 3:117997086-117997108
Sequence AGAAGCGCTCCGGTTCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465965_960465983 21 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465983 3:117997130-117997152 GCCCGGCGGCAGGGAGGAGGGGG No data
960465965_960465981 19 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465965_960465975 12 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465965_960465982 20 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465965_960465978 15 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465978 3:117997124-117997146 CCCGGAGCCCGGCGGCAGGGAGG No data
960465965_960465968 -3 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465965_960465988 30 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465988 3:117997139-117997161 CAGGGAGGAGGGGGCGCAAGGGG No data
960465965_960465987 29 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465987 3:117997138-117997160 GCAGGGAGGAGGGGGCGCAAGGG No data
960465965_960465974 11 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465974 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG 0: 1
1: 0
2: 3
3: 25
4: 249
960465965_960465972 7 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465972 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
960465965_960465986 28 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465965_960465970 4 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465965_960465980 18 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465980 3:117997127-117997149 GGAGCCCGGCGGCAGGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465965 Original CRISPR AGAAGCGCTCCGGTTCTGGA TGG (reversed) Intergenic