ID: 960465967

View in Genome Browser
Species Human (GRCh38)
Location 3:117997096-117997118
Sequence CGGTGGAGTAAGAAGCGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465967_960465978 5 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465978 3:117997124-117997146 CCCGGAGCCCGGCGGCAGGGAGG No data
960465967_960465980 8 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465980 3:117997127-117997149 GGAGCCCGGCGGCAGGGAGGAGG No data
960465967_960465981 9 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465967_960465987 19 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465987 3:117997138-117997160 GCAGGGAGGAGGGGGCGCAAGGG No data
960465967_960465988 20 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465988 3:117997139-117997161 CAGGGAGGAGGGGGCGCAAGGGG No data
960465967_960465970 -6 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465967_960465975 2 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465967_960465990 26 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465967_960465986 18 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465967_960465989 25 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465989 3:117997144-117997166 AGGAGGGGGCGCAAGGGGTCAGG No data
960465967_960465983 11 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465983 3:117997130-117997152 GCCCGGCGGCAGGGAGGAGGGGG No data
960465967_960465974 1 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465974 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG No data
960465967_960465972 -3 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465972 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
960465967_960465982 10 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465967 Original CRISPR CGGTGGAGTAAGAAGCGCTC CGG (reversed) Intergenic