ID: 960465968

View in Genome Browser
Species Human (GRCh38)
Location 3:117997106-117997128
Sequence TCTTACTCCACCGACCACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465961_960465968 24 Left 960465961 3:117997059-117997081 CCGCAGGACTTGTAAATAAACCC No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465966_960465968 -7 Left 960465966 3:117997090-117997112 CCAGAACCGGAGCGCTTCTTACT No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465965_960465968 -3 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465963_960465968 4 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data
960465964_960465968 3 Left 960465964 3:117997080-117997102 CCTGTTCCATCCAGAACCGGAGC No data
Right 960465968 3:117997106-117997128 TCTTACTCCACCGACCACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465968 Original CRISPR TCTTACTCCACCGACCACCC CGG Intergenic