ID: 960465969

View in Genome Browser
Species Human (GRCh38)
Location 3:117997113-117997135
Sequence CCGGGCTCCGGGGTGGTCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465969_960465983 -6 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465983 3:117997130-117997152 GCCCGGCGGCAGGGAGGAGGGGG No data
960465969_960465981 -8 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465969_960465980 -9 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465980 3:117997127-117997149 GGAGCCCGGCGGCAGGGAGGAGG No data
960465969_960465986 1 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465969_960465989 8 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465989 3:117997144-117997166 AGGAGGGGGCGCAAGGGGTCAGG No data
960465969_960465987 2 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465987 3:117997138-117997160 GCAGGGAGGAGGGGGCGCAAGGG No data
960465969_960465988 3 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465988 3:117997139-117997161 CAGGGAGGAGGGGGCGCAAGGGG No data
960465969_960465982 -7 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465969_960465990 9 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465969 Original CRISPR CCGGGCTCCGGGGTGGTCGG TGG (reversed) Intergenic