ID: 960465970

View in Genome Browser
Species Human (GRCh38)
Location 3:117997113-117997135
Sequence CCACCGACCACCCCGGAGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465965_960465970 4 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465964_960465970 10 Left 960465964 3:117997080-117997102 CCTGTTCCATCCAGAACCGGAGC No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465967_960465970 -6 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465963_960465970 11 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
960465966_960465970 0 Left 960465966 3:117997090-117997112 CCAGAACCGGAGCGCTTCTTACT No data
Right 960465970 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465970 Original CRISPR CCACCGACCACCCCGGAGCC CGG Intergenic