ID: 960465971

View in Genome Browser
Species Human (GRCh38)
Location 3:117997116-117997138
Sequence CCGCCGGGCTCCGGGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465971_960465989 5 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465989 3:117997144-117997166 AGGAGGGGGCGCAAGGGGTCAGG No data
960465971_960465982 -10 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465971_960465990 6 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465971_960465986 -2 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465971_960465988 0 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465988 3:117997139-117997161 CAGGGAGGAGGGGGCGCAAGGGG No data
960465971_960465983 -9 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465983 3:117997130-117997152 GCCCGGCGGCAGGGAGGAGGGGG No data
960465971_960465987 -1 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465987 3:117997138-117997160 GCAGGGAGGAGGGGGCGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465971 Original CRISPR CCGCCGGGCTCCGGGGTGGT CGG (reversed) Intergenic