ID: 960465975

View in Genome Browser
Species Human (GRCh38)
Location 3:117997121-117997143
Sequence CACCCCGGAGCCCGGCGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465967_960465975 2 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465963_960465975 19 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465966_960465975 8 Left 960465966 3:117997090-117997112 CCAGAACCGGAGCGCTTCTTACT No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465965_960465975 12 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data
960465964_960465975 18 Left 960465964 3:117997080-117997102 CCTGTTCCATCCAGAACCGGAGC No data
Right 960465975 3:117997121-117997143 CACCCCGGAGCCCGGCGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465975 Original CRISPR CACCCCGGAGCCCGGCGGCA GGG Intergenic