ID: 960465981

View in Genome Browser
Species Human (GRCh38)
Location 3:117997128-117997150
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465965_960465981 19 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465963_960465981 26 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465966_960465981 15 Left 960465966 3:117997090-117997112 CCAGAACCGGAGCGCTTCTTACT No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465967_960465981 9 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465964_960465981 25 Left 960465964 3:117997080-117997102 CCTGTTCCATCCAGAACCGGAGC No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data
960465969_960465981 -8 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465981 3:117997128-117997150 GAGCCCGGCGGCAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type