ID: 960465982

View in Genome Browser
Species Human (GRCh38)
Location 3:117997129-117997151
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465965_960465982 20 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465963_960465982 27 Left 960465963 3:117997079-117997101 CCCTGTTCCATCCAGAACCGGAG 0: 1
1: 0
2: 0
3: 5
4: 84
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465966_960465982 16 Left 960465966 3:117997090-117997112 CCAGAACCGGAGCGCTTCTTACT No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465967_960465982 10 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465971_960465982 -10 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465969_960465982 -7 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data
960465964_960465982 26 Left 960465964 3:117997080-117997102 CCTGTTCCATCCAGAACCGGAGC No data
Right 960465982 3:117997129-117997151 AGCCCGGCGGCAGGGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type