ID: 960465986

View in Genome Browser
Species Human (GRCh38)
Location 3:117997137-117997159
Sequence GGCAGGGAGGAGGGGGCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465977_960465986 -10 Left 960465977 3:117997124-117997146 CCCGGAGCCCGGCGGCAGGGAGG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465973_960465986 -6 Left 960465973 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465965_960465986 28 Left 960465965 3:117997086-117997108 CCATCCAGAACCGGAGCGCTTCT No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465967_960465986 18 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465976_960465986 -9 Left 960465976 3:117997123-117997145 CCCCGGAGCCCGGCGGCAGGGAG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465971_960465986 -2 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465969_960465986 1 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data
960465966_960465986 24 Left 960465966 3:117997090-117997112 CCAGAACCGGAGCGCTTCTTACT No data
Right 960465986 3:117997137-117997159 GGCAGGGAGGAGGGGGCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465986 Original CRISPR GGCAGGGAGGAGGGGGCGCA AGG Intergenic