ID: 960465990

View in Genome Browser
Species Human (GRCh38)
Location 3:117997145-117997167
Sequence GGAGGGGGCGCAAGGGGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960465969_960465990 9 Left 960465969 3:117997113-117997135 CCACCGACCACCCCGGAGCCCGG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465979_960465990 -3 Left 960465979 3:117997125-117997147 CCGGAGCCCGGCGGCAGGGAGGA No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465985_960465990 -10 Left 960465985 3:117997132-117997154 CCGGCGGCAGGGAGGAGGGGGCG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465977_960465990 -2 Left 960465977 3:117997124-117997146 CCCGGAGCCCGGCGGCAGGGAGG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465971_960465990 6 Left 960465971 3:117997116-117997138 CCGACCACCCCGGAGCCCGGCGG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465973_960465990 2 Left 960465973 3:117997120-117997142 CCACCCCGGAGCCCGGCGGCAGG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465976_960465990 -1 Left 960465976 3:117997123-117997145 CCCCGGAGCCCGGCGGCAGGGAG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465967_960465990 26 Left 960465967 3:117997096-117997118 CCGGAGCGCTTCTTACTCCACCG No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data
960465984_960465990 -9 Left 960465984 3:117997131-117997153 CCCGGCGGCAGGGAGGAGGGGGC No data
Right 960465990 3:117997145-117997167 GGAGGGGGCGCAAGGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960465990 Original CRISPR GGAGGGGGCGCAAGGGGTCA GGG Intergenic