ID: 960470394

View in Genome Browser
Species Human (GRCh38)
Location 3:118057591-118057613
Sequence GATTTCCACAAAACCTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960470394_960470399 26 Left 960470394 3:118057591-118057613 CCACCTAAGGTTTTGTGGAAATC No data
Right 960470399 3:118057640-118057662 TTTGATATCCAAAATGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960470394 Original CRISPR GATTTCCACAAAACCTTAGG TGG (reversed) Intergenic
No off target data available for this crispr