ID: 960473812

View in Genome Browser
Species Human (GRCh38)
Location 3:118099332-118099354
Sequence ATCAGCTGCCTGGCCTACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960473810_960473812 10 Left 960473810 3:118099299-118099321 CCTTAATGAATGTATCTGCAGTA No data
Right 960473812 3:118099332-118099354 ATCAGCTGCCTGGCCTACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960473812 Original CRISPR ATCAGCTGCCTGGCCTACAG TGG Intergenic
No off target data available for this crispr