ID: 960475990

View in Genome Browser
Species Human (GRCh38)
Location 3:118129547-118129569
Sequence CTGAATATACACATTGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960475989_960475990 24 Left 960475989 3:118129500-118129522 CCTAAGACAAGGACGTTTCATGT No data
Right 960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960475990 Original CRISPR CTGAATATACACATTGACAG TGG Intergenic
No off target data available for this crispr