ID: 960480112

View in Genome Browser
Species Human (GRCh38)
Location 3:118177730-118177752
Sequence GCTTAGAGATTCAACCCCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960480107_960480112 9 Left 960480107 3:118177698-118177720 CCTCCAGTCTTTCACTTACTTTC No data
Right 960480112 3:118177730-118177752 GCTTAGAGATTCAACCCCCGTGG No data
960480108_960480112 6 Left 960480108 3:118177701-118177723 CCAGTCTTTCACTTACTTTCCCT No data
Right 960480112 3:118177730-118177752 GCTTAGAGATTCAACCCCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960480112 Original CRISPR GCTTAGAGATTCAACCCCCG TGG Intergenic
No off target data available for this crispr