ID: 960489837 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:118302603-118302625 |
| Sequence | AAAAGTTAATATGGAGACAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960489837_960489840 | 2 | Left | 960489837 | 3:118302603-118302625 | CCAATGTCTCCATATTAACTTTT | No data | ||
| Right | 960489840 | 3:118302628-118302650 | CCAGCAATTCCAATTGTTATTGG | No data | ||||
| 960489837_960489841 | 6 | Left | 960489837 | 3:118302603-118302625 | CCAATGTCTCCATATTAACTTTT | No data | ||
| Right | 960489841 | 3:118302632-118302654 | CAATTCCAATTGTTATTGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960489837 | Original CRISPR | AAAAGTTAATATGGAGACAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||