ID: 960489838

View in Genome Browser
Species Human (GRCh38)
Location 3:118302612-118302634
Sequence TTGCTGGAAAAAAGTTAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960489838_960489840 -7 Left 960489838 3:118302612-118302634 CCATATTAACTTTTTTCCAGCAA No data
Right 960489840 3:118302628-118302650 CCAGCAATTCCAATTGTTATTGG No data
960489838_960489841 -3 Left 960489838 3:118302612-118302634 CCATATTAACTTTTTTCCAGCAA No data
Right 960489841 3:118302632-118302654 CAATTCCAATTGTTATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960489838 Original CRISPR TTGCTGGAAAAAAGTTAATA TGG (reversed) Intergenic
No off target data available for this crispr