ID: 960489841

View in Genome Browser
Species Human (GRCh38)
Location 3:118302632-118302654
Sequence CAATTCCAATTGTTATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960489837_960489841 6 Left 960489837 3:118302603-118302625 CCAATGTCTCCATATTAACTTTT No data
Right 960489841 3:118302632-118302654 CAATTCCAATTGTTATTGGCAGG No data
960489838_960489841 -3 Left 960489838 3:118302612-118302634 CCATATTAACTTTTTTCCAGCAA No data
Right 960489841 3:118302632-118302654 CAATTCCAATTGTTATTGGCAGG No data
960489835_960489841 24 Left 960489835 3:118302585-118302607 CCTCAGAAACATAGCCTTCCAAT No data
Right 960489841 3:118302632-118302654 CAATTCCAATTGTTATTGGCAGG No data
960489836_960489841 10 Left 960489836 3:118302599-118302621 CCTTCCAATGTCTCCATATTAAC No data
Right 960489841 3:118302632-118302654 CAATTCCAATTGTTATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960489841 Original CRISPR CAATTCCAATTGTTATTGGC AGG Intergenic
No off target data available for this crispr