ID: 960494744

View in Genome Browser
Species Human (GRCh38)
Location 3:118360762-118360784
Sequence GGCCTGTTACTTGACTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960494744_960494749 25 Left 960494744 3:118360762-118360784 CCACCAAAGTCAAGTAACAGGCC No data
Right 960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG No data
960494744_960494750 26 Left 960494744 3:118360762-118360784 CCACCAAAGTCAAGTAACAGGCC No data
Right 960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG No data
960494744_960494746 -3 Left 960494744 3:118360762-118360784 CCACCAAAGTCAAGTAACAGGCC No data
Right 960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG No data
960494744_960494748 21 Left 960494744 3:118360762-118360784 CCACCAAAGTCAAGTAACAGGCC No data
Right 960494748 3:118360806-118360828 GAGTAGTTATCTGAAGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960494744 Original CRISPR GGCCTGTTACTTGACTTTGG TGG (reversed) Intergenic
No off target data available for this crispr