ID: 960494746

View in Genome Browser
Species Human (GRCh38)
Location 3:118360782-118360804
Sequence GCCAAGAGCAGTCTCTCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960494740_960494746 19 Left 960494740 3:118360740-118360762 CCCATAGTCAAACCTTCAGTTTC No data
Right 960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG No data
960494741_960494746 18 Left 960494741 3:118360741-118360763 CCATAGTCAAACCTTCAGTTTCC No data
Right 960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG No data
960494745_960494746 -6 Left 960494745 3:118360765-118360787 CCAAAGTCAAGTAACAGGCCAAG No data
Right 960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG No data
960494742_960494746 7 Left 960494742 3:118360752-118360774 CCTTCAGTTTCCACCAAAGTCAA No data
Right 960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG No data
960494744_960494746 -3 Left 960494744 3:118360762-118360784 CCACCAAAGTCAAGTAACAGGCC No data
Right 960494746 3:118360782-118360804 GCCAAGAGCAGTCTCTCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960494746 Original CRISPR GCCAAGAGCAGTCTCTCAAA AGG Intergenic
No off target data available for this crispr