ID: 960494747

View in Genome Browser
Species Human (GRCh38)
Location 3:118360783-118360805
Sequence TCCTTTTGAGAGACTGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960494747_960494751 27 Left 960494747 3:118360783-118360805 CCAAGAGCAGTCTCTCAAAAGGA No data
Right 960494751 3:118360833-118360855 GCCTTGCTCCAAAATCCTAAAGG No data
960494747_960494748 0 Left 960494747 3:118360783-118360805 CCAAGAGCAGTCTCTCAAAAGGA No data
Right 960494748 3:118360806-118360828 GAGTAGTTATCTGAAGATGATGG No data
960494747_960494749 4 Left 960494747 3:118360783-118360805 CCAAGAGCAGTCTCTCAAAAGGA No data
Right 960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG No data
960494747_960494750 5 Left 960494747 3:118360783-118360805 CCAAGAGCAGTCTCTCAAAAGGA No data
Right 960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960494747 Original CRISPR TCCTTTTGAGAGACTGCTCT TGG (reversed) Intergenic
No off target data available for this crispr