ID: 960494750

View in Genome Browser
Species Human (GRCh38)
Location 3:118360811-118360833
Sequence GTTATCTGAAGATGATGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960494745_960494750 23 Left 960494745 3:118360765-118360787 CCAAAGTCAAGTAACAGGCCAAG No data
Right 960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG No data
960494747_960494750 5 Left 960494747 3:118360783-118360805 CCAAGAGCAGTCTCTCAAAAGGA No data
Right 960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG No data
960494744_960494750 26 Left 960494744 3:118360762-118360784 CCACCAAAGTCAAGTAACAGGCC No data
Right 960494750 3:118360811-118360833 GTTATCTGAAGATGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960494750 Original CRISPR GTTATCTGAAGATGATGGCA GGG Intergenic
No off target data available for this crispr