ID: 960498437

View in Genome Browser
Species Human (GRCh38)
Location 3:118405736-118405758
Sequence ATCTAGTTATTTTGGTAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960498434_960498437 3 Left 960498434 3:118405710-118405732 CCTTTTTGTAGTTCAACTTCTAA No data
Right 960498437 3:118405736-118405758 ATCTAGTTATTTTGGTAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960498437 Original CRISPR ATCTAGTTATTTTGGTAATT GGG Intergenic
No off target data available for this crispr