ID: 960498725

View in Genome Browser
Species Human (GRCh38)
Location 3:118409012-118409034
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960498725_960498734 29 Left 960498725 3:118409012-118409034 CCGAAATCTTGATAATAACCCTG No data
Right 960498734 3:118409064-118409086 TATCTACGGAAACCATAAGCAGG No data
960498725_960498731 15 Left 960498725 3:118409012-118409034 CCGAAATCTTGATAATAACCCTG No data
Right 960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960498725 Original CRISPR CAGGGTTATTATCAAGATTT CGG (reversed) Intergenic
No off target data available for this crispr