ID: 960498729

View in Genome Browser
Species Human (GRCh38)
Location 3:118409031-118409053
Sequence ACATGACAGAGGCTGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960498729_960498731 -4 Left 960498729 3:118409031-118409053 CCTGGAGGCAGCCTCTGTCATGT No data
Right 960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG No data
960498729_960498734 10 Left 960498729 3:118409031-118409053 CCTGGAGGCAGCCTCTGTCATGT No data
Right 960498734 3:118409064-118409086 TATCTACGGAAACCATAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960498729 Original CRISPR ACATGACAGAGGCTGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr