ID: 960498731

View in Genome Browser
Species Human (GRCh38)
Location 3:118409050-118409072
Sequence ATGTCCCACTAAAATATCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960498728_960498731 -3 Left 960498728 3:118409030-118409052 CCCTGGAGGCAGCCTCTGTCATG No data
Right 960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG No data
960498725_960498731 15 Left 960498725 3:118409012-118409034 CCGAAATCTTGATAATAACCCTG No data
Right 960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG No data
960498729_960498731 -4 Left 960498729 3:118409031-118409053 CCTGGAGGCAGCCTCTGTCATGT No data
Right 960498731 3:118409050-118409072 ATGTCCCACTAAAATATCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960498731 Original CRISPR ATGTCCCACTAAAATATCTA CGG Intergenic
No off target data available for this crispr