ID: 960499591

View in Genome Browser
Species Human (GRCh38)
Location 3:118420064-118420086
Sequence CAATACCCAAATCATATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960499590_960499591 -5 Left 960499590 3:118420046-118420068 CCTTGGCGTAAACTAGAACAATA No data
Right 960499591 3:118420064-118420086 CAATACCCAAATCATATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960499591 Original CRISPR CAATACCCAAATCATATGTC AGG Intergenic
No off target data available for this crispr