ID: 960500359

View in Genome Browser
Species Human (GRCh38)
Location 3:118430462-118430484
Sequence TCTGATATCCAGAATGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960500359_960500361 23 Left 960500359 3:118430462-118430484 CCTTATACATTCTGGATATCAGA No data
Right 960500361 3:118430508-118430530 AAATATTTTCTCCCATTCTGTGG 0: 1067
1: 2377
2: 3404
3: 4287
4: 3840
960500359_960500362 24 Left 960500359 3:118430462-118430484 CCTTATACATTCTGGATATCAGA No data
Right 960500362 3:118430509-118430531 AATATTTTCTCCCATTCTGTGGG 0: 2307
1: 13777
2: 17745
3: 9853
4: 5024

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960500359 Original CRISPR TCTGATATCCAGAATGTATA AGG (reversed) Intergenic
No off target data available for this crispr