ID: 960500361 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:118430508-118430530 |
| Sequence | AAATATTTTCTCCCATTCTG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 14975 | |||
| Summary | {0: 1067, 1: 2377, 2: 3404, 3: 4287, 4: 3840} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960500359_960500361 | 23 | Left | 960500359 | 3:118430462-118430484 | CCTTATACATTCTGGATATCAGA | No data | ||
| Right | 960500361 | 3:118430508-118430530 | AAATATTTTCTCCCATTCTGTGG | 0: 1067 1: 2377 2: 3404 3: 4287 4: 3840 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960500361 | Original CRISPR | AAATATTTTCTCCCATTCTG TGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||