ID: 960500442

View in Genome Browser
Species Human (GRCh38)
Location 3:118431292-118431314
Sequence AAATATTTTCTCCCATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14975
Summary {0: 1067, 1: 2377, 2: 3404, 3: 4287, 4: 3840}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960500440_960500442 23 Left 960500440 3:118431246-118431268 CCTTATACATTCTGGATATCAGA No data
Right 960500442 3:118431292-118431314 AAATATTTTCTCCCATTCTGTGG 0: 1067
1: 2377
2: 3404
3: 4287
4: 3840

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960500442 Original CRISPR AAATATTTTCTCCCATTCTG TGG Intergenic
Too many off-targets to display for this crispr