ID: 960500443 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:118431293-118431315 |
| Sequence | AATATTTTCTCCCATTCTGT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 48706 | |||
| Summary | {0: 2307, 1: 13777, 2: 17745, 3: 9853, 4: 5024} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 960500440_960500443 | 24 | Left | 960500440 | 3:118431246-118431268 | CCTTATACATTCTGGATATCAGA | No data | ||
| Right | 960500443 | 3:118431293-118431315 | AATATTTTCTCCCATTCTGTGGG | 0: 2307 1: 13777 2: 17745 3: 9853 4: 5024 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 960500443 | Original CRISPR | AATATTTTCTCCCATTCTGT GGG | Intergenic | ||
| Too many off-targets to display for this crispr | |||||