ID: 960500443

View in Genome Browser
Species Human (GRCh38)
Location 3:118431293-118431315
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48706
Summary {0: 2307, 1: 13777, 2: 17745, 3: 9853, 4: 5024}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960500440_960500443 24 Left 960500440 3:118431246-118431268 CCTTATACATTCTGGATATCAGA No data
Right 960500443 3:118431293-118431315 AATATTTTCTCCCATTCTGTGGG 0: 2307
1: 13777
2: 17745
3: 9853
4: 5024

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr