ID: 960504211

View in Genome Browser
Species Human (GRCh38)
Location 3:118473193-118473215
Sequence GTGGTCAGAATTAGAATTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960504211_960504213 7 Left 960504211 3:118473193-118473215 CCAACAATTCTAATTCTGACCAC No data
Right 960504213 3:118473223-118473245 ATCAAATCTGAGCTGAAGCATGG No data
960504211_960504216 16 Left 960504211 3:118473193-118473215 CCAACAATTCTAATTCTGACCAC No data
Right 960504216 3:118473232-118473254 GAGCTGAAGCATGGGGTTCTAGG No data
960504211_960504214 8 Left 960504211 3:118473193-118473215 CCAACAATTCTAATTCTGACCAC No data
Right 960504214 3:118473224-118473246 TCAAATCTGAGCTGAAGCATGGG No data
960504211_960504215 9 Left 960504211 3:118473193-118473215 CCAACAATTCTAATTCTGACCAC No data
Right 960504215 3:118473225-118473247 CAAATCTGAGCTGAAGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960504211 Original CRISPR GTGGTCAGAATTAGAATTGT TGG (reversed) Intergenic
No off target data available for this crispr