ID: 960507735

View in Genome Browser
Species Human (GRCh38)
Location 3:118513779-118513801
Sequence CTCAAGGACAATTGGATCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960507735_960507742 12 Left 960507735 3:118513779-118513801 CCATGGATCCAATTGTCCTTGAG No data
Right 960507742 3:118513814-118513836 TTTTCTGTGATATGCTCCATGGG No data
960507735_960507741 11 Left 960507735 3:118513779-118513801 CCATGGATCCAATTGTCCTTGAG No data
Right 960507741 3:118513813-118513835 CTTTTCTGTGATATGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960507735 Original CRISPR CTCAAGGACAATTGGATCCA TGG (reversed) Intergenic
No off target data available for this crispr