ID: 960508015

View in Genome Browser
Species Human (GRCh38)
Location 3:118516542-118516564
Sequence AATTAGCTGCAAATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960508008_960508015 20 Left 960508008 3:118516499-118516521 CCTGGCCAACATGGCAAAACCCC 0: 8131
1: 28392
2: 108920
3: 195222
4: 205144
Right 960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG No data
960508012_960508015 -1 Left 960508012 3:118516520-118516542 CCACCTCTACTTAAAATACAAAA 0: 20
1: 6267
2: 209920
3: 137492
4: 61264
Right 960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG No data
960508013_960508015 -4 Left 960508013 3:118516523-118516545 CCTCTACTTAAAATACAAAAATT 0: 22
1: 4794
2: 5998
3: 5323
4: 3870
Right 960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG No data
960508011_960508015 0 Left 960508011 3:118516519-118516541 CCCACCTCTACTTAAAATACAAA 0: 15
1: 2984
2: 99323
3: 249254
4: 149392
Right 960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG No data
960508009_960508015 15 Left 960508009 3:118516504-118516526 CCAACATGGCAAAACCCCACCTC 0: 205
1: 5931
2: 18880
3: 76892
4: 122973
Right 960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG No data
960508010_960508015 1 Left 960508010 3:118516518-118516540 CCCCACCTCTACTTAAAATACAA 0: 12
1: 2728
2: 91795
3: 178717
4: 171819
Right 960508015 3:118516542-118516564 AATTAGCTGCAAATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960508015 Original CRISPR AATTAGCTGCAAATGATGGC AGG Intergenic
No off target data available for this crispr