ID: 960513657

View in Genome Browser
Species Human (GRCh38)
Location 3:118579418-118579440
Sequence AGAGTTGGACAGTTGCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960513657_960513664 27 Left 960513657 3:118579418-118579440 CCCTGTTGCAACTGTCCAACTCT No data
Right 960513664 3:118579468-118579490 ACTATATGTAGATATGGGCATGG No data
960513657_960513663 22 Left 960513657 3:118579418-118579440 CCCTGTTGCAACTGTCCAACTCT No data
Right 960513663 3:118579463-118579485 TATGGACTATATGTAGATATGGG No data
960513657_960513662 21 Left 960513657 3:118579418-118579440 CCCTGTTGCAACTGTCCAACTCT No data
Right 960513662 3:118579462-118579484 CTATGGACTATATGTAGATATGG No data
960513657_960513661 4 Left 960513657 3:118579418-118579440 CCCTGTTGCAACTGTCCAACTCT No data
Right 960513661 3:118579445-118579467 TTGTAGTTCAAAAGCAGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960513657 Original CRISPR AGAGTTGGACAGTTGCAACA GGG (reversed) Intergenic
No off target data available for this crispr