ID: 960514149

View in Genome Browser
Species Human (GRCh38)
Location 3:118584380-118584402
Sequence CTTTTCAAGTGTAGCCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960514146_960514149 13 Left 960514146 3:118584344-118584366 CCTGACTCTGTCTAATTAATGTG No data
Right 960514149 3:118584380-118584402 CTTTTCAAGTGTAGCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960514149 Original CRISPR CTTTTCAAGTGTAGCCAGTA AGG Intergenic
No off target data available for this crispr