ID: 960515974

View in Genome Browser
Species Human (GRCh38)
Location 3:118603220-118603242
Sequence CAACATGTTTCAAGGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960515974_960515976 -6 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515976 3:118603237-118603259 ATGTTGCCTTCCTCAGTCTGTGG No data
960515974_960515979 8 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515979 3:118603251-118603273 AGTCTGTGGAAACTTTCCATAGG No data
960515974_960515982 23 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data
960515974_960515981 14 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515974_960515980 13 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515980 3:118603256-118603278 GTGGAAACTTTCCATAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960515974 Original CRISPR CAACATGTTTCAAGGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr