ID: 960515975

View in Genome Browser
Species Human (GRCh38)
Location 3:118603228-118603250
Sequence GAGGAAGGCAACATGTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960515975_960515982 15 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data
960515975_960515980 5 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515980 3:118603256-118603278 GTGGAAACTTTCCATAGGCAAGG No data
960515975_960515981 6 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515975_960515979 0 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515979 3:118603251-118603273 AGTCTGTGGAAACTTTCCATAGG No data
960515975_960515984 24 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515984 3:118603275-118603297 AAGGGCAGAAGTGGTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960515975 Original CRISPR GAGGAAGGCAACATGTTTCA AGG (reversed) Intergenic
No off target data available for this crispr