ID: 960515977

View in Genome Browser
Species Human (GRCh38)
Location 3:118603243-118603265
Sequence AAGTTTCCACAGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960515977_960515981 -9 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515977_960515980 -10 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515980 3:118603256-118603278 GTGGAAACTTTCCATAGGCAAGG No data
960515977_960515984 9 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515984 3:118603275-118603297 AAGGGCAGAAGTGGTAGAGCAGG No data
960515977_960515982 0 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960515977 Original CRISPR AAGTTTCCACAGACTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr