ID: 960515981

View in Genome Browser
Species Human (GRCh38)
Location 3:118603257-118603279
Sequence TGGAAACTTTCCATAGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960515974_960515981 14 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515975_960515981 6 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515972_960515981 24 Left 960515972 3:118603210-118603232 CCTACTCCTTCCTAGCTTCCTTG No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515973_960515981 18 Left 960515973 3:118603216-118603238 CCTTCCTAGCTTCCTTGAAACAT No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data
960515977_960515981 -9 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515981 3:118603257-118603279 TGGAAACTTTCCATAGGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960515981 Original CRISPR TGGAAACTTTCCATAGGCAA GGG Intergenic
No off target data available for this crispr