ID: 960515982

View in Genome Browser
Species Human (GRCh38)
Location 3:118603266-118603288
Sequence TCCATAGGCAAGGGCAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960515973_960515982 27 Left 960515973 3:118603216-118603238 CCTTCCTAGCTTCCTTGAAACAT No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data
960515977_960515982 0 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data
960515975_960515982 15 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data
960515974_960515982 23 Left 960515974 3:118603220-118603242 CCTAGCTTCCTTGAAACATGTTG No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data
960515978_960515982 -4 Left 960515978 3:118603247-118603269 CCTCAGTCTGTGGAAACTTTCCA No data
Right 960515982 3:118603266-118603288 TCCATAGGCAAGGGCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960515982 Original CRISPR TCCATAGGCAAGGGCAGAAG TGG Intergenic
No off target data available for this crispr