ID: 960515984

View in Genome Browser
Species Human (GRCh38)
Location 3:118603275-118603297
Sequence AAGGGCAGAAGTGGTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960515978_960515984 5 Left 960515978 3:118603247-118603269 CCTCAGTCTGTGGAAACTTTCCA No data
Right 960515984 3:118603275-118603297 AAGGGCAGAAGTGGTAGAGCAGG No data
960515975_960515984 24 Left 960515975 3:118603228-118603250 CCTTGAAACATGTTGCCTTCCTC No data
Right 960515984 3:118603275-118603297 AAGGGCAGAAGTGGTAGAGCAGG No data
960515977_960515984 9 Left 960515977 3:118603243-118603265 CCTTCCTCAGTCTGTGGAAACTT No data
Right 960515984 3:118603275-118603297 AAGGGCAGAAGTGGTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960515984 Original CRISPR AAGGGCAGAAGTGGTAGAGC AGG Intergenic
No off target data available for this crispr