ID: 960524951

View in Genome Browser
Species Human (GRCh38)
Location 3:118699031-118699053
Sequence TGGAAAAATACCACCTGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960524951_960524954 -2 Left 960524951 3:118699031-118699053 CCCATACAGGTGGTATTTTTCCA No data
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960524951 Original CRISPR TGGAAAAATACCACCTGTAT GGG (reversed) Intergenic
No off target data available for this crispr