ID: 960524954

View in Genome Browser
Species Human (GRCh38)
Location 3:118699052-118699074
Sequence CATAGTTTTTCCATAACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960524945_960524954 15 Left 960524945 3:118699014-118699036 CCAAATACCACCTGTACCCCATA 0: 5
1: 27
2: 702
3: 1621
4: 2256
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data
960524949_960524954 5 Left 960524949 3:118699024-118699046 CCTGTACCCCATACAGGTGGTAT No data
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data
960524950_960524954 -1 Left 960524950 3:118699030-118699052 CCCCATACAGGTGGTATTTTTCC No data
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data
960524947_960524954 8 Left 960524947 3:118699021-118699043 CCACCTGTACCCCATACAGGTGG No data
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data
960524952_960524954 -3 Left 960524952 3:118699032-118699054 CCATACAGGTGGTATTTTTCCAT No data
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data
960524951_960524954 -2 Left 960524951 3:118699031-118699053 CCCATACAGGTGGTATTTTTCCA No data
Right 960524954 3:118699052-118699074 CATAGTTTTTCCATAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960524954 Original CRISPR CATAGTTTTTCCATAACTTA TGG Intergenic
No off target data available for this crispr