ID: 960528043

View in Genome Browser
Species Human (GRCh38)
Location 3:118732826-118732848
Sequence GGTCTGAGAGGAAAACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960528038_960528043 7 Left 960528038 3:118732796-118732818 CCATATGCCATCATGTGGACCAC No data
Right 960528043 3:118732826-118732848 GGTCTGAGAGGAAAACAAAGAGG No data
960528039_960528043 0 Left 960528039 3:118732803-118732825 CCATCATGTGGACCACAGAAGCA No data
Right 960528043 3:118732826-118732848 GGTCTGAGAGGAAAACAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960528043 Original CRISPR GGTCTGAGAGGAAAACAAAG AGG Intergenic
No off target data available for this crispr