ID: 960529115

View in Genome Browser
Species Human (GRCh38)
Location 3:118743373-118743395
Sequence CAGTAATAGGAGAGGTAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960529115_960529119 13 Left 960529115 3:118743373-118743395 CCTCATTACCTCTCCTATTACTG No data
Right 960529119 3:118743409-118743431 CATGTAAAATCCTCAAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960529115 Original CRISPR CAGTAATAGGAGAGGTAATG AGG (reversed) Intergenic
No off target data available for this crispr