ID: 960533292

View in Genome Browser
Species Human (GRCh38)
Location 3:118789248-118789270
Sequence GGGTGGAATGGGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533292_960533302 -6 Left 960533292 3:118789248-118789270 CCCTGCCCCATCCCATTCCACCC No data
Right 960533302 3:118789265-118789287 CCACCCCAAATCGGGCATCCAGG No data
960533292_960533307 15 Left 960533292 3:118789248-118789270 CCCTGCCCCATCCCATTCCACCC No data
Right 960533307 3:118789286-118789308 GGCAGCCATGCCTTCACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533292 Original CRISPR GGGTGGAATGGGATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr