ID: 960533535

View in Genome Browser
Species Human (GRCh38)
Location 3:118792341-118792363
Sequence TTTGCTTTGTAATGAATCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533534_960533535 -1 Left 960533534 3:118792319-118792341 CCTCATCTTTGAAAATACAGGGT No data
Right 960533535 3:118792341-118792363 TTTGCTTTGTAATGAATCTTAGG No data
960533531_960533535 5 Left 960533531 3:118792313-118792335 CCAATGCCTCATCTTTGAAAATA No data
Right 960533535 3:118792341-118792363 TTTGCTTTGTAATGAATCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533535 Original CRISPR TTTGCTTTGTAATGAATCTT AGG Intergenic
No off target data available for this crispr