ID: 960533678

View in Genome Browser
Species Human (GRCh38)
Location 3:118793440-118793462
Sequence GGGCCTGACCTAGACTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
960533678_960533688 30 Left 960533678 3:118793440-118793462 CCCCTCCAGTCTAGGTCAGGCCC No data
Right 960533688 3:118793493-118793515 TTTCCTTTATTCCTCCTCTCAGG No data
960533678_960533682 -4 Left 960533678 3:118793440-118793462 CCCCTCCAGTCTAGGTCAGGCCC No data
Right 960533682 3:118793459-118793481 GCCCCTATTATACATTTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
960533678 Original CRISPR GGGCCTGACCTAGACTGGAG GGG (reversed) Intergenic